Sunday, November 30, 2014

Why do leaves turn color in the fall?

Depending on where you live in the world, the final months of the year may bring cooler temperatures, shorter days, and bright autumn leaves. It is precisely these cooler temperatures and the decrease in daylight which results in changes in the leaves of some trees and bushes. 


Throughout the growing seasons of spring and summer, the tree is hard at work transforming sunlight and carbon dioxide into sugars- some of which are stored for the dormant seasons of fall and winter. The cells of leaves contain pigment called chlorophyll, which is responsible for the absorption of sunlight and giving leaves their bright, green color. Leaves contain other pigments which are not as noticeable for much of the year. This includes carotenoids (a bright yellow-orange pigment) and anthocyanins (which create a reddish-purple hue.)


Have you ever seen a plant which has been watered too much, but has received too little sunlight? The leaves tend to turn yellow. Similarly, towards the end of summer and beginning of fall, leaves on trees will take on a yellow color. This is because the tree is responding to a decrease in sunlight, and is not producing more chlorophyll to replace that which has already broken down. In the height of autumn, we can observe these yellow leaves turning orange, red, and even plum or brown. The carotenoid pigments are still present, and a buildup of sugars which have not been stored in the tree gives way to high levels of anthocyanins. 


Differing amounts of sunlight and temperature fluctuations may make this process a slow or fast one, with relatively dull or brilliant color displays. The United States Forest Service says that the best conditions for bright, colorful leaves is several days of bright light and crisp- but not too chilly- nighttime. This ensures that the production of sugars is high in the leaf, but becomes "trapped" as the veins of the leaf close off in the cool night. 

Why do Bud's eyes not cry anymore?

Bud first tells his readers that his eyes don't cry anymore in chapter one.  Already by this point in Bud's life he has been through a lot of hardship.  His mom died when he was six years old, and he has been in and out of foster homes over the past four years.  The orphanage that he is currently in is awful as well.  The Great Depression is in full swing, so money for food and clothing for orphans is almost non-existent.  


I think Bud's eyes "don't cry no more" because he has become hardened and numb to the misery and hardship that he is in. Additionally, he has had to grow up fast and learn to be tough to survive.  He sees crying as something that shows weakness.



I knew if I was a regular kid I'd be crying buckets of tears now, I didn't want these men to think I was a baby so I was real glad that my eyes don't cry no more.



Of course Bud does eventually cry uncontrollably in chapter 14.  He does this because he finally sheds a little bit of his tough exterior. While out to dinner with the band, Bud begins to feel a little bit of love and joy.  Plus, the band members are people that Bud believes that he can trust.  They are people that won't hurt Bud or take advantage of him. All of that knowledge comes flooding into Bud's brain, and he is able to let go of the misery and sadness that he has been holding back for so long.  



I was smiling and laughing and busting my gut so much that I got carried away and some rusty old valve squeaked open in me then -- woop, zoop, sloop -- tears started jumping out of my eyes so hard that I had to cover my face with the big red and white napkin that was on the table.


A double stranded fragment of viral DNA, one of whose strand is shown below, encodes two peptides, called vir-1 and vir-2. Adding this...

First, we need to write out the complimentary strand to the strand shown. We can already tell, just by looking at the strand provided, that vir1 will be encoded on one of the strands, and vir2 will be coded on the complimentary strand; we know this because each sequence needs to begin with the DNA sequence TAC, but in the strand provided, there are two TAC sequences that are too close together to provide both a 10 and a 5 residue product.


Following the GCAT pairing rules, we get the double strand:


1. AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT


2. TCTAGCCTACGAGTTGATATACACTAATTGTCTCGTACGCCGTATTTGA


We know strand one must be read right-to-left, because this is the only way a TAC sequence appears. Therefore, strand 2 must be read left-to-right. The TAC sequences are highlighted below:


1. AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT


2. TCTAGCCTACGAGTTGATATACACTAATTGTCTCGTACGCCGTATTTGA


Since it's not immediately obvious which TAC is the correct one, we can look for stop sequences as well. Stop, in DNA, is encoded by TAG, TAA and TGA


1. AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT


2. TCTAGCCTACGAGTTGATATACACTAATTGTCTCGTACGCCGTATTTGA



If we look carefully at these sequences, we can eliminate some that are situated in such a way that they are incompatible with the TAC sequences and with the 10 and 5 residue products we expect. Some of them are also not found in the same 3-base sequence when counted from a given TAC starting point. However, none of the possible sequences provide a 10-residue or 5-residue product. I believe this was due to the original sequence being written or assigned incorrectly; researching this question online shows that it appears in multiple forms, some of which are not possible to transcribe using the criteria shown. Furthermore, other versions of this question show the original sequence as being 5' to 3', and since DNA is always transcribed 5' to 3', this means a TAC sequence needs to be visible in left-to-right viewing in order for this question to be solved. 

Saturday, November 29, 2014

Compare and contrast the reasons for Britain's and Japan's industrialisation.

The most important contrast is that Britain industrialized long before Japan.

Britain was at the forefront of the Industrial Revolution, investing heavily in coal power and iron production as early as the 1760s.

Japan did not seriously industrialize until a century later, in the Meiji Restoration starting in the late 1860s.

For Britain, industrialization was a fundamentally new innovation; they were applying the most recent discoveries in science to create new modes of production and dramatically expand economic output.

For Japan, industrialization was a defensive action; they saw that Europe and the United States were overtaking them technologically, economically, and militarily, and redoubled their efforts to catch up.

The triggering event for Japan's industrialization was actually an act of quite literal gunboat diplomacy by the United States; in 1853, Commodore Matthew Perry brought a small fleet into Tokyo Bay and demanded that Japan open itself to trade with the US. Before that, Japan had been fiercely isolationist, a policy known as sakoku. But once they began to trade with the US, they realized how far behind they were and how much they were missing out on in terms of technology and prosperity. Another important consideration, of course, was the fear that US military technology would allow Japan to be easily conquered. (Ultimately, they were unable to prevent that outcome, only delaying it until 1945.)

Still, the actual pattern of industrialization between the two countries was quite similar: Expansion of trade, development of coal and steel as vital inputs to production, improvement of agricultural technology to dramatically increase food output and free up laborers to work in factories. Even the progression of different industries was quite similar, starting in low-tech manufacturing such as textiles, going through capital-intensive manufacturing such as steel and trains, and ultimately culminating centuries later with high-tech manufacturing such as computers and automobiles. Today both the United Kingdom and Japan are world leaders in electronics manufacturing.

The demographic pattern during industrialization was also quite similar: Britain's small population expanded greatly; Japan's already large population grew enormous. Economic output grew even faster, resulting in a rapidly rising standard of living; but this wealth was not distributed evenly, so inequality rose as the rich became richer must faster than the poor became less poor.

Would you consider the 2016 election the biggest political election of our lifetime? Why or why not?

“Our lifetime” encompasses quite a few elections. The student who posed the question—is the 2016 election the “biggest” of our lifetime—is probably in his/her twenties. The person writing this response is in his fifties. Whether the 2016 election is more important than the first of my lifetime, the one that featured old-school conservatism in the person of then-Vice President Richard Nixon against a young, confident and attractive liberal senator from New England named John Kennedy, is difficult to say. Kennedy’s election, which ushered in the idealistic notion of American political royalty that became known as “Camelot,” was, in its own way, transformative but for the tragic ending to that brief era. The 1968 contest between Nixon and Hubert Humphrey took place against a backdrop of tremendous social and political turbulence, with protests and riots against the war in Vietnam and for civil rights occurring at the same time that same old-school conservative, Nixon, was to be finally elected to the office of the presidency rather than the liberal Humphrey. That, however, is my lifetime. The campaigns for the presidency of Ronald Reagan and Jimmy Carter were, in their way, illustrative of the period in which they took place. Carter’s election in 1976 represented the end of an era—the post-World War II consensus on foreign policy that had, to a certain extent, existed among both political parties, and the degradation of American politics represented by the Watergate scandal—while his subsequent defeat by Reagan in his bid for reelection represented a mandate among much of the public for a more vigorous administration that would strengthen the United States militarily after years of relative decline. All of these were important, or “big,” elections. Obviously, the election of the nation's first African American president is more than a little noteworthy, although the actual governing part of the equation is less transformative than the ethnic or racial element of it.


All of that said, the current election process is without a doubt one of the more transformative ones of recent history. The ugliness of the ongoing process is hardly unique in the annals of American political history, with name-calling and “dirty tricks” very much a part of that history. What makes this election “big” is the potential, on the left, for the election of a self-avowed socialist, and the potential, on the right(?) for the election of a populist businessman whose comments on a number of issues have placed him outside the mainstream of American politics—a mainstream that Trump’s popularity may be in the process of upending. Sanders represents a radical transformation in the economics of the most economically-powerful country in the world; Trump represents a somewhat xenophobic, protectionist, ideologically vacuous presence that few can label within the context of this nation’s political history. Whichever of these two prevail would usher in a very new type of administration, one the ramifications of which nobody can confidently predict. Clinton, Rubio and Kasich represent the more pragmatic, traditional perspectives on governing, with Clinton seriously tainted by allegations of corruption and a reputation for dishonesty. The political process, to date, can either be, then, transformative, or represent a rejection of the extremes personified by Trump and Sanders.


For somebody in his or her twenties, this may very well represent the most important election of his or her life. To those of us where are older, however, an answer to that question remains to be seen.

How does prejudice interfere with Jem and Scout's understanding of Mrs. Dubose?

Prejudice or pre-judging a person without full information, emerges in the beginning of the novel as Jem and Scout accept the neighborhood's verdict that Mrs. Dubose is "the meanest old woman who ever lived." Their brief interactions with her do little to dispel their preconceived notions: she calls Scout "you ugly girl," and accuses both children of being sassy and disrespectful. She gazes at them with anger, questions them relentlessly and tells them they won't amount to anything. 


Though they learn from Atticus that Mrs. Dubose is ill, they have trouble mustering sympathy for her. Jen finally gets so angry with Mrs. Dubose that he takes Scout's baton and beheads all of her camellias. When Atticus sends them to her house read Ivanhoe to her, her appearance reinforces their prejudice: she is wrinkled, liver-spotted, drools and has false teeth. 


But as they get to know her better, while she is not particularly kind to them, they become more used to her: When she insults him, Jem can look at her with a face "devoid of resentment." After she dies, the children learn she was a morphine addict who had them read to her as she was trying to get clean. The children, already prejudiced and believing her to be horrible, have trouble seeing past her outer shell to a person in pain. Atticus describes her as a truly courageous person, more so than a person with a gun. We have to imagine that the adult Scout, reflecting back on this part of her life, might finally agree. 

Friday, November 28, 2014

How did Magna Carta, the Hundred Years' War, and the Black Death change European society?

All three of the events in your question contributed to the downfall of the feudal social system of Europe.  Magna Carta was written to protect the rights of citizens from tyrannical  monarchs.  It checked the power of the king and gave more influence on government to the nobles.  This weakened the position of kings and emboldened the noble class.  The 100 Year's War introduced different technologies to warfare that undermined the importance of knights in the feudal system.  The 100 Year's War also further weakened the power of the king as people started to look for parliaments to have more influence on government, especially in England.  The Bubonic Plague had a devastating effect on all classes in the feudal system.  Because death did not discriminate, many powerful manor lords died and their estates were increasingly left behind.  Additionally, the plague had depleted the population of serfs and created a labor shortage.  This gave the lower classes more bargaining power and better wages.  All three of these events greatly diminished the system of feudalism and led to more representative forms of government.  

What is Pseudomonas?


Definition


Pseudomonas is a member of the group of pseudomonads,
which are gram-negative, rod-shaped, obligately aerobic, bacilli that include
similar organisms in the genus Burkholderia.






Natural Habitat and Features

The pseudomonads are commonly found in soil or water, where they play a significant role in the degradation of organic material. In humans, they are part of the normal skin flora and are found in intestinal and respiratory passages; they are generally considered to be harmless saprotrophs. Pseudomonads are distinguished from the enteric bacteria, which they physically resemble (as strictly aerobic and with a nonfermentative metabolism) and because they use the enzyme cytochrome oxidase in their respiratory pathways.


The pseudomonads produce a variety of water-soluble pigments, including the blue pigment pyocyanin and the red pigment pyorubin, and can be easily identified by the grapelike odor many types exhibit when grown on sheep’s blood agar. Some species also produce the greenish pigment pyoverdin, which fluoresces in the presence of ultraviolet light.




Pathogenicity and Clinical Significance


Pseudomonas is considered a harmless organism in healthy persons.
However, in persons with compromised immune systems, it becomes an opportunistic pathogen. It also becomes a pathogen if introduced into
areas of the body that are generally sterile. Pseudomonas
species, in particular aeruginosa, are problematic
pathogens in persons with burns and other wounds to the skin. Under these conditions, the production of pigments by the
bacterium results in a bluish-green pus.


Infections may be difficult to treat because the organism frequently exhibits
resistance to antibiotics. The infection in adults has the potential to
become severe, while in infants the danger significantly increases as the organism
may pass into the bloodstream.



Aeruginosa is among the organisms commonly associated with nosocomial (hospital acquired) infections, in which bacteria are
introduced into the body from respirators or through the use of catheters. The
bacteria can develop a mucoid polysaccharide biofilm on catheters. The biofilm protects the bacterial cells
from the body’s immune defenses. Urinary tract infections too are not
uncommon under these conditions, and as many as 15 percent of such nosocomial
infections are caused by Pseudomonas.


A variety of factors are involved in the pathogenic properties of Pseudomonas once it is introduced into the body. Pili, protein extensions on the cell surface, allow the bacterium to attach to tissues. Once the bacterium has begun to colonize, it secretes several types of enzymes that are damaging to the host. These enzymes include an elastase, which is particularly damaging to respiratory epithelium; a cytotoxin, which can damage or kill white blood cells; and several hemolysins, which can break down red blood cells.



Aeruginosa also produces a toxin called exotoxin A, which acts in a manner similar to that of diphtheria toxin. It inhibits protein synthesis in cells that incorporate the toxin. The result is a potentially systemic disease, as the toxin may be released into the bloodstream.


The pigments produced by many Pseudomonas strains may also
contribute to the potential virulence of the organism. Pyocyanin, a
bluish pigment, impairs the normal functions of respiratory cilia and may also
damage white blood cells. The pigment may also be modified by the bacterium,
allowing it to increase the uptake of iron necessary for the bacterium’s
replication and growth.


Persons with underlying respiratory disease, such as those with compromised
immune systems, chronic lung diseases, or cystic
fibrosis, are at particular risk of
aeruginosa infection. Because these infections are often
caused by strains that produce mucoid layers on the bacterial cell surface, they
are difficult to treat. Bacteremia and the dissemination of
Pseudomonas may spread the organism to the heart (causing
endocarditis) and to the central nervous system (causing
meningitis).


A more common infection is that of otitis externa, an infection of the ear more commonly known as swimmer’s ear, which may result from contaminated water. Swimmer’s ear also may lead to an endogenous infection because Pseudomonas is commonly found among the microbiota already in the ear. Untreated middle- or inner-ear infections have the potential to develop into meningitis. An infection of the eye, keratitis, is less common but may become severe if the immune system has been compromised.


The species fluorescens exhibits many of the same features as aeruginosa. However, it grows poorly at body temperature (98.6° Fahrenheit, or 37° Celsius) and is rarely pathogenic.




Drug Susceptibility


Pseudomonas is naturally resistant to most common antibiotics,
largely because of its own efflux pumps, which efficiently prevent internalization
of such drugs, and because of the type of outer membrane it produces on the
surface of the cell. Many strains of Pseudomonas also possess
resistance transfer factors in the form of plasmids, circular extrachromosomal
pieces of deoxyribonucleic acid (DNA), which contain genes that confer the
resistance to antibiotics. These plasmids may also be passed to other bacteria,
spreading the danger of antibiotic resistance.


Surface infections such as otitis externa may be treated with polymyxin.
However, this antibiotic is too toxic for internal use. Most therapy for
Pseudomonas infections utilizes combinations of drugs that act
at different levels of metabolism. Although Pseudomonas is
resistant to penicillin, combinations of the penicillin derivative
piperacillin, which inhibits cell-wall formation, and the aminoglycoside
tobramycin, an inhibitor of protein synthesis, have proven effective. Other
antibiotics useful in the treatment of Pseudomonas infections
include gentamycin, imipenem, aztreonam, and quinolones such as ciprofloxacin.
Strains may differ in their susceptibility.




Bibliography


Brooks, George, et al. Jawetz, Melnick, and Adelberg’s Medical Microbiology. 25th ed. New York: McGraw-Hill, 2010.



Forbes, Betty A., Daniel F. Sahm, and Alice S. Weissfeld. Bailey and Scott’s Diagnostic Microbiology. 12th ed. St. Louis, Mo.: Mosby/Elsevier, 2007.



Murray, Patrick, et al., eds. Manual of Clinical Microbiology. 9th ed. Washington, D.C.: ASM Press, 2007.



Salyers, Abigail A., and Dixie D. Whitt. Bacterial Pathogenesis: A Molecular Approach. 2d ed. Washington, D.C.: ASM Press, 2002.

Thursday, November 27, 2014

On what page in The Lord of the Flies does Ralph say "While we’re waiting we can have a good time on this island…It’s like a book"?

In Chapter 2, Ralph tells the boys that they can have a good time on the island while they wait for their parents to come rescue them. 


At some indeterminate time, a group of boys is stranded on an island during a nuclear war.  Their plane crashes and the pilot is killed.  There are no adults, and only boys.  As far as they know, no one is aware of where they are and there is no plan for rescuing them.


This conversation with the boys happens near the beginning of Chapter 2.  They are discussing how much fun the island can be without any adults around.  It can be like an island adventure in a book. 



“It’s like in a book.”


At once there was a clamor.


“Treasure Island–”


“Swallows and Amazons–”


“Coral Island–”


Ralph waved the conch.


“This is our island. It’s a good island. Until the grownups come to fetch us we’ll have fun.” (Ch. 2, p. 32) 



At this meeting, the little boys push forward one of the littuns, the one with the mulberry colored birthmark.  He tells them there is a beastie on the island.  The beastie turns the island from a safe, parent-free amusement park to a place of potential danger.  It also adds some potential excitement.  Now it really is like a storybook!



“Tell us about the snake-thing.”


“Now he says it was a beastie.”


“Beastie?”


“A snake-thing. Ever so big. He saw it.”


“Where?”


“In the woods.” (Ch. 2, p. 33)



The beastie becomes the secret fear for the rest of the book.  No one ever really sees it, and it is a manifestation of the boys' doubts and fears.  They are a bunch of boys stranded alone on an island with no adults, undependable leadership, and slim chance of rescue.  They certainly have a lot of unknowns to fear.  The beastie gives them something specific to worry about which is also vaguely supernatural.


Please note that different book editions will have different page numbers (these page numbers are from the 2005 paperback), but this incident occurs near the beginning of Chapter 2.

Wednesday, November 26, 2014

What is integrative medicine?


Overview

According to Andrew Weil, a prominent physician and a proponent of this
system, integrative medicine (IM) works with the body’s natural potential for
healing. In the human body, many pathways and mechanisms serve to maintain health
and promote healing. The IM perspective recognizes that treatment, often a
combination of allopathic and alternative medicine, should unblock and enhance
these mechanisms.


In practice, the therapeutic process addresses the whole person and relies on
the main pillars of a person’s well-being: mind, body, spirit, and community. This
paradigm emphasizes the importance of a sound physician-patient relationship for a
successful healing process. Developing rapport and empathy greatly facilitates the
efficacy of lifestyle changes and the use of therapies such as pharmaceuticals,
homeopathy, dietary supplements, traditional Chinese
medicine, Ayurveda, manual methods, mind/body
techniques, and movement therapy.


Until the 1970s, little was done to connect traditional, ancient healing modalities to biomedicine. At that time, the holistic health movement in the United States and in Western Europe started a “dynamic alliance” of therapists, including Native American healers, yoga teachers, and homeopaths. Modern medicine began taking steps to reduce the excessive use of technology and the inherent disconnect from the patient, while rediscovering more natural, less invasive avenues of healing.


The Consortium of Academic Health Centers for Integrative Medicine, founded in 2000, brings together many highly esteemed academic medical centers dedicated to promoting IM through educational opportunities, health policies, research, and collaborative initiatives. The term “integrative medicine” will most likely be used until the value of this balanced approach becomes widely recognized as simply good medicine.






Mechanism of Action

Integrative medicine combines conventional medical treatments with carefully selected alternative therapies that are proven to be safe and effective. The goal of the integrative movement is to bring back the art of healing and to address the root of the pathological process, not just the symptoms. In addition to acquiring the foundations of medical knowledge, physicians should be able to release, explore, and exploit the intrinsic healing responses of the body. Practitioners are therefore encouraged to become familiar with, and critically assess, the modalities of complementary and alternative medicine (CAM).


Core areas of education include the philosophy of science, cross-cultural
medicine, principles of mind/body medicine, self-healing, and
spirituality. The practitioner’s ability to self-explore and maintain his or her
own health balance are considered essential for the therapeutic act. The physician
strives to become a partner and a mentor, who understands the important
coordinates of his or her patient’s life events, culture, beliefs, and
relationships. By acknowledging a person’s uniqueness, the processes of health
maintenance and healing are tailored to best address a person’s background and
conditions. Matching the patient’s belief system can, especially in chronic
illness, lead to the activation of an internal healing response, often known as
the placebo
effect. Far from being a useless phenomenon based on
deception, this response ultimately results in enhanced health.




Uses and Applications

Overall, IM is a combination of art and science that seeks health maintenance and disease prevention and treatment using the most natural, least invasive interventions available. Virtually all categories of disorders, and especially chronic diseases, can benefit from an integrated approach.



Cardiovascular disorders. Cardiovascular disorders such as
congestive heart failure, coronary artery disease, hypertension, and peripheral
vascular disease can be treated with conventional methods and with lifestyle
modifications, nutrition, dietary supplements (omega-3 fatty acids, coenzyme
Q10, carnitine, arginine, hawthorn, and garlic), relaxation,
meditation, and hydrotherapy. Primary prevention is critical in coronary
artery disease and hypertension.



Cancer. Cancer can be treated with the synergistic reduction of the sequellae and by limiting the toxicity or trauma of conventional therapies and by alleviating psychological distress. Nutritional changes, dietary supplements (vitamins, immunomodulators, ginger, marijuana, and St. John’s wort), acupuncture, mind/body techniques, and group support are often recommended. Preventive approaches (for breast cancer, for example) involve lifestyle changes (exercise, nutrition, limiting toxins, and breast-feeding), botanicals (seaweed, rosemary, and green tea), and mind/body methods.



Endocrine and metabolic disorders. Endocrine and metabolic disorders are also amenable to integrated therapies. Insulin resistance is often treated with metformin hydrochloride, lifestyle changes, and a low-carbohydrate diet. Supplements such as chromium, vanadium, alpha-lipoic acid, American ginseng, and fenugreek can provide benefits too. In persons with diabetes mellitus, essential care includes diet, exercise, and pharmaceuticals. Dietary supplements, such as vitamins, bilberry, and Ginkgo biloba, and mind/body techniques (for example, relaxation and yoga) may mitigate vascular disease and even lower glucose levels. Alternative therapies to consider in persons with hypothyroidism include dietary supplements such as vitamins, zinc, selenium, and traditional Chinese botanicals, and practices such as yoga. Pharmaceuticals are available for the treatment of osteoporosis, and vitamin D, ipriflavone, and exercise constitute useful adjuvants.



Gastrointestinal disorders. Gastroesophageal reflux, peptic ulcer
disease, and irritable bowel syndrome can be treated with lifestyle changes and
with botanicals (licorice, chamomile, and marshmallow root), homeopathics, and
mind/body therapies (including stress management and guided
imagery).



Neurological disorders. Stroke, multiple sclerosis, Alzheimer’s
disease, Parkinson’s disease, seizures, and migraine have been linked to oxidative
stress, neurotoxic factors, and inflammatory processes. Thus, they can greatly
benefit from integrative methods. The complementary therapies include, but are not
limited to, dietary and nutritional supplementation (omega-3 fatty acids,
glutathione, coenzyme Q10, alpha-lipoic acid, N-acetylcysteine, niacin,
vitamins, melatonin, and magnesium), herbal supplementation (Ginkgo
biloba
, milk thistle, turmeric, vinpocetine, and skullcap),
meditation, yoga, and exercise.



Asthma and allergies. Asthma and allergies respond well to alternative methods that include nutritional and environmental changes, exercise, botanicals (ginkgo, coleus, licorice, kanpo, bioflavonoids, and stinging nettle), vitamins and minerals, homeopathics, massage, inhalation, breathing techniques, and mind/body therapy.



Upper respiratory infections and sinusitis. Upper respiratory infections and sinusitis can be treated with pharmaceuticals, dietary changes, hydration, steam inhalation, supplements (vitamins, antioxidants, zinc, magnesium, garlic, and echinacea), and homeopathic remedies.



Depression and anxiety. Depression and anxiety represent a
spectrum of disorders ideally suited for IM. In addition to pharmaceuticals,
persons can benefit from lifestyle changes, physical activity, nutritional
remedies (omega-3 fatty acids, B vitamins, folic acid, and hydroxytryptophan),
botanical remedies (St. John’s wort, kava kava, and ginkgo), psychotherapy, relaxation training, yoga, acupuncture, and
transcranial stimulation.



Pain. Pain management represents a challenge for both the
physician and the person in pain. Truly integrating allopathic and alternative
medicines can offer relief and reduce frustration. Reassurance and lifestyle
changes are often the first step of the therapeutic plan. A vast array of useful
approaches includes pharmacotherapy, exercise, supplements (arnica and omega-3
fatty acids), homeopathy, manual methods, acupuncture,
transcutaneous nerve stimulation, and mind/body therapy. Surgery is considered
after conservative therapies have failed.



Pregnancy and menopause. The integrative approach to pregnancy and menopause reaches beyond the use of combined mainstream and alternative therapies. These conditions require a careful initial encounter and subsequent consideration of the mind, body, spirit, and community context. The patient-practitioner interaction is oriented toward health rather than disease, and listening to the person seeking care is essential. In pregnancy especially, the need for noninvasive, natural approaches becomes crucial. Nausea and vomiting, for example, are treated with supplements (vitamin B6, red raspberry leaf, ginger root, and chamomile), homeopathics, acupuncture, and mind/body therapies.



Alcoholism and substance abuse. Therapeutic options for alcoholism and substance abuse include botanicals (valerian, kudzu, kava kava), acupuncture, mind/body therapies, and spirituality. The options also include twelve-step programs.




Scientific Evidence

Integrative practice is committed to the scientific method and is rooted in evidence. At the same time, the integrative practitioner aims to transcend the confines of “scientific truth” and connect with the people he or she serves on multiple levels.


A number of CAM therapies have proved effective as complements to conventional medical treatments. These CAM therapies include dietary and herbal supplements, acupuncture, manual therapy, biofeedback, relaxation training, and movement therapy. When a strong evidence base is developed for a particular complementary method, it can become part of the integrative armamentarium. After it reviewed the evidence base, for example, the Society for Integrative Oncology supported the use of acupuncture in cases in which cancer-related pain is poorly controlled.


According to the American Academy of Pediatrics, a review conducted in 2002
found more than fourteen hundred randomized-control trials of pediatric CAM; the
quality of these trials was determined to be as good as those focusing on
conventional therapies. It is important to note that different levels of evidence
are required to prove the safety and efficacy of complementary therapies,
depending on the goals of the treatment. Lower levels of evidence (that is,
nonrandomized and observational studies) are acceptable for preventive or
supportive goals and for noninvasive approaches. Furthermore, integrating
represents more than combining; it involves holistic
treatment and the synergistic application of an array of
treatments. Thus, the extent of the combination or integration varies. This leads
to unique challenges for the scientific validation of integrative methods.
Traditional research models often appear inadequate. More studies are needed that
examine the appropriateness and manner of integration for specific diseases and
conditions.




Choosing a Practitioner

Approximately 70 percent of medical schools in the United States have courses in CAM. Integrative medicine centers and fellowship programs exist at many prominent universities and hospitals in the United States, including the University of Arizona, Duke University, Harvard University, the University of Michigan, and the Mayo Clinic. These centers tend to be directed by conventional physicians (doctors of medicine and doctors of osteopathy) and staffed by various practitioners.


The American Board of Integrative Holistic Medicine establishes standards for the application of IM principles and offers certification. The American Association of Integrative Medicine provides an accreditation program. Even so, qualified IM practitioners are still difficult to find, and the demand greatly exceeds the supply. Oftentimes, the collaboration between conventional physicians of various specialties and certified CAM practitioners provides the foundation and benefits of integrative care. The American Holistic Medical Association maintains a directory of integrative and holistic practitioners holding relevant degrees.




Safety Issues

When implemented by physicians and CAM practitioners who are well versed in the integrative method, IM is safe and beneficial.




Bibliography


American Association of Integrative Medicine. http://www.aaimedicine.com. Promotes the development of IM.



American Board of Integrative Holistic Medicine. http://integrativeholisticdoctors.org. Establishes and maintains standards of care.



American Holistic Medical Association. http://www.holisticmedicine.org. Promotes holistic and integrative principles.



Consortium of Academic Health Centers for Integrative Medicine. http://www.imconsortium.org. Advances the principles and practice of integrative health care within academic institutions.



Baer, Hans. Toward an Integrative Medicine: Merging Alternative Therapies with Biomedicine. Walnut Creek, Calif.: Altamira Press, 2004. A comprehensive overview of the holistic movement and its journey into mainstream medicine.



Kurn, Sidney, and Sheryl Shook. Integrated Medicine for Neurologic Disorders. Albuquerque, N.Mex.: Health Press, 2008. Review of nutritional and herbal therapies for practitioners who treat persons with neurological disorders.



Leis, A. M., L. C. Weeks, and M. J. Verhoef. “Principles to Guide Integrative Oncology and the Development of an Evidence Base.” Current Oncology 15, suppl. 2 (2008): S83-S87. Discusses the need for evidence to support the overall practice of integration and the challenges posed by the validation process.



Rakel, David, ed. Integrative Medicine. 2d ed. Philadelphia: Saunders/Elsevier, 2007. An authoritative textbook that discusses the philosophy and method of integrative medicine and details therapeutic modalities for numerous diseases and conditions.



Rees, L., and A. Weil. “Integrated Medicine [Editorial].” British Medical Journal 322 (2001): 119-120. Defines the basic tenets of IM.

How does Macbeth reveal that he is struggling with conflicting ideas?

Macbeth is a complex character. He displays the tension between his "black and deep desires" and the moral principles which must be obeyed. He shows this tension in his soliloquies in which he lets us know about his fears and doubts. One of the soliloquies that allows us to examine his inner conflict more closely is in Act I, Scene 7. 


In this soliloquy, Macbeth reveals that he should not kill king Duncan for three major reasons. Firstly, Duncan is his king and Macbeth should be his loyal subject. Secondly, they are relatives, so it'd be abnormal and against nature to kill Duncan. Thirdly, Macbeth will be his host, so as a host, Macbeth should protect his guest, not murder him.


Nevertheless, Macbeth admits that his ambition is the one that still motivates him to follow through with his plan. And even when it seems he will stop with his plan, Lady Macbeth pushes him forward and manipulates him into going after his unchecked ambition. Once he kills Duncan, Macbeth slowly transforms himself into a cold-blooded tyrant. 

What is self-disclosure?


Introduction

Self-disclosure is the process of communicating personal information to another
individual. It involves a willingness to reveal intimate thoughts and feelings
rather than superficial or obvious characteristics. Scientists studying personal
relationships have found that, as two people become acquainted and interact over
time, they reveal more of themselves to each other. For example, when two people
first know each other, their conversation may be limited to the weather, mutual
interests, and similarly “safe” topics. The topics they discuss are neutral, and
the feelings they express are matters of public knowledge. As their relationship
develops, they feel comfortable disclosing more intimate feelings and experiences.
Later in their friendship, their conversation may be entirely about their
feelings, personal problems, and other experiences that are not public knowledge.
Self-disclosure is the process by which communication in a relationship becomes
more private and intimate.


The term “self-disclosure” was introduced by psychologist Sidney Jourard in his
1964 book The Transparent Self: Self-Disclosure and Well-Being.
Early work by therapists and researchers speculated that self-disclosure is
essential for the health and growth of personal relationships; however, not all
self-disclosures serve to promote relationships. Disclosures can be distinguished
as either appropriate or inappropriate. Healthy intimacy is
promoted when one’s self-disclosure suits the time and the place as well as the
relationship. When two people are close friends, for example, it is appropriate
for them to reveal personal information or feelings to each other.


In contrast, confessing intimate feelings or confiding personal experiences to
a stranger or mild acquaintance is often considered inappropriate. Personal
revelations are often too intimate for those interactions. Such inappropriate
self-disclosure may elicit withdrawal or rejection by others. Self-disclosure can
also be inappropriate because it is not intimate enough. For example, if two
long-time friends converse about their lives and one refuses to tell the other
about a problem because it is somewhat personal, the other may feel rejected or
slighted. Because of their history as friends, personal confidences are
appropriate, while nondisclosure is not.




Levels of Communication

The quality of self-disclosure was considered in the 1973 book Social
Penetration: The Development of Interpersonal Relationships
, by Irwin
Altman and Dalmas Taylor. Altman and Taylor argued that, as a relationship
develops, communication between partners increases in two qualities or dimensions:
breadth and depth. Breadth increases before depth. Communication becomes broader
as partners add more topic areas to their conversation. Eventually the two
people’s communication also deepens: Their interaction becomes less superficial
and more intimate. For example, two people whose early friendship is based on a
common interest in music will discover other things in common (greater breadth) as
they communicate. Eventually, they not only talk about what they mutually enjoy
but also confide in each other and help each other solve problems (greater
depth).


Altman and Taylor argue that most relationships develop in a more satisfactory
way when self-disclosure proceeds (breadth before depth) over time; however, not
all individuals conform to this model. For example, some persons are low
revealers, unable to proceed to more personal levels of communication over time.
Others are high revealers, indiscriminately disclosing too much to others,
irrespective of the exact relationships or interactions between them. Disclosing
too little prevents a relationship from becoming more intimate and may result in
its termination. Disclosing too much signals intrusiveness rather than intimacy,
and it usually causes others to withdraw rather than to respond with equal
intimacy.


Healthy self-disclosure adheres to a norm of reciprocity—the expectation that partners will exchange disclosures, taking turns revealing similar levels of intimacy. For example, if one partner confides to the other, “I am worried that I might not succeed in reaching this goal,” the other can reciprocate by admitting similar feelings or understanding the fear of failure. It would not be reciprocal to change the subject or offer superficial reassurance such as, “I know you will do just fine.” Self-disclosure is risky, because it makes the revealer more vulnerable to the confidant’s rejection or ridicule. Reciprocal self-disclosure establishes trust, since partners are confiding on similar levels and their knowledge of each other is balanced.


As relationships develop, Altman has argued, immediate reciprocity becomes
unnecessary, because trust has already been established. Thus, long-time friends
can have nonreciprocal conversations without threatening their level of intimacy.
In a particular interaction, one partner may confide while the other listens
without reciprocating. They both know that their roles can be reversed in some
future conversation.


Disclosure depends on the style as well as the content of communication. An
individual may wish to discuss a personal problem or concern with a friend but not
know how to express himself or herself effectively. The complaint, “Sometimes
things can be very hard for a person to deal with,” is more vague and less
disclosing than the statement, “I feel very frustrated and need help solving a
problem.” In this example, the former disclosure is closed and impersonal while
the latter is more open and personal. To be open and personal, self-disclosing
statements should be relevant to the immediate situation, expressed in personal
terms (“I feel” rather than “People say”), specifically addressed to the listener,
clearly explanatory rather than vague or hinting, and specific rather than
general.




Role in Relationships

Differences in patterns of self-disclosure can account for differences in relationship development, conflict, personal distress, and loneliness. Individual differences in self-disclosure—the fact that some people are high revealers and others low revealers—help explain why some relationships become more intimate while others never progress. For example, a low revealer may feel unable to reciprocate when a new friend confides a secret or problem. The nondiscloser may be unsure of the other’s response to a personal revelation, fearful of rejection, or unable to express himself or herself. The friend who has confided in the nondiscloser is left feeling unsatisfied or mistrustful by the lack of response and may discourage future interactions.


In contrast, a high revealer’s indiscriminate disclosures can offend others. Overdisclosing to a stranger can cause him or her to withdraw and terminate any further interaction. Even friends can be disturbed by a high revealer’s willingness to confide inappropriately to others besides themselves. Their own confidences in the overdiscloser may also seem to be at risk. Differences in people’s willingness and ability to engage in self-disclosure can affect the success and development of their relationships.


Research and theory on self-disclosure contribute to a larger body of work on communication in close relationships. The study of relationships combines the observations and perspectives of social psychology, sociology, counseling, and communication studies. Early work in this multidisciplinary field focused on how relationships begin, including motivations for affiliation and factors in interpersonal attraction. Researchers have since turned their attention to relationship development and maintenance, processes dependent on the quality and quantity of partners’ communication. Self-disclosure is a central goal of intimate communication. An understanding of self-disclosure and its role in developing and maintaining intimacy is essential to improving and stabilizing the significant relationships in people’s lives.




Exceptions to Self-Disclosure Rules

Two kinds of interactions may appear to violate the rules of developing
self-disclosure: brief intimate encounters and love at first sight. In the first
case, a brief interaction with a stranger involves unusually deep self-disclosure.
Psychologist Zick Rubin has dubbed this the Fort Lauderdale phenomenon, for the
Florida city that is a popular destination for spring vacation travel. A college
student on vacation may feel less inhibited about self-disclosure with others
encountered there, because he or she will not see any of these people again. Thus,
high levels of self-disclosure are possible because no future relationship is
anticipated.


In love at first sight, two people may become quickly and mutually attracted
and communicate intimately with each other with the intention of maintaining their
relationship in the future. Altman and Taylor warn, however, that the two
individuals have no history of communication, so no trust has been established
between them. The risk of conflict is high, and conflict is likely to be more
destructive than if the relationship had been established more gradually. Thus,
disclosing too much too fast can doom a relationship even when disclosure is
reciprocal and when both partners have similar motives.




Role in Psychological Well-Being

The relationship between psychological adjustment
and quantity or amount of self-disclosure has been explored by Valerian Derlega
and Alan Chaikin in their 1975 book Sharing Intimacy: What We Reveal to
Others and Why
. Derlega and Chaikin suggest that adjustment is a
curvilinear (changing) function of self-disclosure, rather than a linear
(constant) one. A person’s adjustment does not continually increase as the amount
that he or she self-discloses increases. Initially, as self-disclosure increases
from low to medium levels, adjustment also improves—up to a point. Beyond that
optimal point, increasing from medium to high self-disclosure actually reduces
psychological adjustment. In other words, disclosing too much can interfere with a
person’s well-being and relationship success.


Self-disclosure is important to psychological well-being. Friends value being
able to talk to and be themselves with each other. Intimacy involves more than
being honest and revealing secrets, however; it is possible to express oneself
about personal concerns without participating in an intimate relationship. For
example, one may keep a diary or confide in a pet. There are also some
relationships that have no expectation of reciprocity. A patient or client must
describe personal experiences and feelings to a physician or psychotherapist
without expecting him or her to respond in kind. In these contexts, it is helpful
to be able to express oneself honestly without fear of rejection or criticism.
Research evidence confirms that the process of articulating and confiding one’s
concerns significantly helps in coping with stress and
trauma. Diaries and professional relationships are not a substitute for real
intimacy, however; genuine intimacy is an outcome of communication within
relationships, not of one-sided expression. Confiding in others who are willing to
listen is essential to gaining the benefits of social
support.




Issues of Intimacy

Personal relationships are based on interdependence—the reliance of both parties on joint outcomes. Reciprocity in self-disclosure represents a mutual investment that builds such interdependence. Withholding a confidence at one extreme and overdisclosing at the other are both hindrances to satisfactory intimacy. People who fail to establish and maintain intimacy with others experience loneliness. Loneliness is defined as the experience of inadequate or insufficient relationships. People feel lonely when they have fewer relationships than are wanted or when existing relationships fail to meet their needs. A pattern of inappropriate or inexpressive self-disclosure can ultimately lead one to experience chronic loneliness.


Training in social skills may help those who suffer the consequences of
unsatisfactory relationships or loneliness. Individuals could be taught, in psychotherapy or support
groups, to modify their self-disclosure. Overdisclosers could become selective in
choosing their confidants, and low revealers could learn how to express themselves
more openly and personally. Like other relationship skills, self-disclosure
requires motivation and competence but contributes to better
communication and higher self-esteem.




Influences and Evolution of Study

Research on self-disclosure was influenced by the human potential movement of
the 1960s and 1970s. Early theorists such as Jourard argued that it is important
to be able to reveal aspects of oneself to a few significant others. Work by
Altman and Taylor and by Derlega and Chaikin extended the concept of
self-disclosure into the context of personal relationships and communication. Work
conducted in the 1970s and 1980s explored the ways people choose topics and levels
in disclosing to others. Self-disclosure has come to be regarded more as an aspect
of interpersonal communication than of self-development. Whether a disclosure is
appropriate depends on the relationship of the discloser to the listener and on
the expectations of both individuals.


Altman and Taylor’s theory of social penetration recognizes
that self-disclosure involves changes in both the quantity and quality of intimate
communication. Later research has concentrated on identifying the qualities of
appropriate and healthy communication. An understanding of how self-disclosure is
developed and how it contributes to communication is important in the study of
close relationships; identifying problems in self-disclosure can lead to solving
those problems. Research on loneliness has led to the development of social-skills
training programs. Similarly, self-disclosure skills can be improved with
education based on an understanding of intimate communication.




Bibliography


Adler, Ronald B.,
Lawrence B. Rosenfeld, and Neil Towne. Interplay: The Process of
Interpersonal Communication
. 11th ed. New York: Oxford UP, 2009.
Print.



Altman, Irwin, and
Dalmas A. Taylor. Social Penetration: The Development of
Interpersonal Relationships
. New York: Holt, 2006.
Print.



Brehm, Sharon S.
Intimate Relationships. 4th ed. New York: McGraw-Hill,
2006. Print.



Brewer, Gayle, Loren Abell, and Minna Lyons.
"Machiavellianism, Competition, and Self-Disclosure in Friendship."
Individual Differences Research 12.1 (2014): 1–7.
Print.



Derlega, Valerian,
Sandra Metts, Sandra Petronio, and Steven Margulies, eds.
Self-Disclosure. Thousand Oaks: Sage, 1993.
Print.



Duck, Steve.
Relating to Others. 2nd ed. Buckingham: Open UP, 1999.
Print.



Eunjung Lee. "A Therapist's Self-Disclosure
and Its Impact on the Therapy Process in Cross-Cultural Encounters:
Disclosure of Personal Self, Professional Self, and/or Cultural Self?"
Families in Society 95.1 (2014): 15–23.
Print.



Knapp, Mark L., and
Anita L. Vangelisti. Interpersonal Communication and Human
Relationships
. 6th ed. Boston: Allyn, 2009. Print.



Stoltz, Molly, Raymond W. Young, Kevin L.
Bryant. "Can Teacher Self-Disclosure Increase Student Cognitive Learning?"
College Student Journal 48.1 (2014): 166–72.
Print.



Voncken M., and K. Dijk. "Socially Anxious
Individuals Get a Second Chance after Being Disliked at First Sight: The
Role of Self-Disclosure in the Development of Likeability in Sequential
Social Contact." Cognitive Therapy and Research 37.1
(2013): 7–17. Print.

I have a 6 liter container and I put iron and water in it: 3Fe + 4H2O > Fe3O4 + 4H2 This is an equilibrium reaction and the constant of...

For the given well balanced reaction:


`3Fe + 4H_2O -> Fe_3O_4 + 4H_2`


the equilibrium constant can be written as:


`K_c = 0.38 = ([Fe_3O_4][H_2]^4)/([Fe]^3 [H_2O]^4)`


where, [] sign indicates the molar concentration of each substance in mol/l.


Let us assume that we started with "x" g of water. Since 50 g of water is left after the equilibrium has been established, the amount of water that has reacted is x - 50 g.


Since the molar mass of water is 18 g/mole (= 2 x 1 + 16), the moles of water that have been consumed are (x-50)/18. Since, the container has a volume of 6 l, the molar concentration of water that has reacted is given as (x-50)/(18x6) moles/l.


Using stoichiometry, 4 moles of water generate 4 moles of H2. Thus the concentration of H2 is (x-50)/(18x6) mol/l. 


4 moles of water generates 1 mole of Fe3O4. Thus the concentration of Fe3O4 is (x-50)/(18x6x4) mol/l.


And the moles of Fe consumed are (3/4) x [(x-50)/(18x6)] mol/l.


Substituting all these values into the equation for equilibrium constant and solving,  


we get, x = 184.87 g


The moles of water consumed = (x-50)/18 = 7.493 moles of water


Moles of Fe consumed are 3/4 x 7.493 = 5.62 moles. Using the atomic mass of iron (55.85 g/mole), amount of Fe consumed is 313.85 g. 


Thus, the moles of Fe3O4 generated are (x-50)/(18x6x6) = 1.873 moles. Since the molar mass of Fe3O4 is 231.55 g (= 3 x 55.85 + 4 x 16), the amount of Fe3O4 produced is 433.69 g.


Similarly, moles of hydrogen generated are the same of moles of water consumed and thus, are equal to 7.493 moles. Since the molar mass of H2 is 2 g/mole, the amount of H2 generated is 14.986 g or about 15 g.


Hope this helps. 

What is cocaine use disorder?


Causes

Cocaine is a powerful central nervous system stimulant that causes the brain to release large amounts of the hormone dopamine. Dopamine, a neurotransmitter associated with feelings of pleasure, floods the brain’s reward pathways and results in the euphoria commonly reported by cocaine users. As a person continues to use cocaine, a tolerance is developed. This means that more frequent use and higher doses are required to achieve the same feeling of euphoria. Repeated use of cocaine can result in long-term disruptions to the brain’s dopamine levels and reward circuitry.




When a cocaine user stops using abruptly, he or she experiences a crash or withdrawal. This results in an extremely strong craving for more cocaine. It also results in fatigue, loss of pleasure in life, depression, anxiety, irritability, and paranoia. These withdrawal symptoms often prompt the user to seek more cocaine.




Risk Factors

Being male and between the ages of eighteen and twenty-five years are considered factors that increase one’s chances of developing cocaine use disorder.




Symptoms

The short-term effects associated with cocaine use include euphoria, increased energy, mental alertness, decreased need for food and sleep, dilated pupils, increased temperature, increased heart rate, increased blood pressure, erratic or violent behavior, vertigo, muscle twitches, paranoia, restlessness, irritability, and anxiety. A cocaine overdose can result in a dangerous elevation of blood pressure, leading to stroke, heart failure, or even sudden death


The long-term effects include uncontrollable or unpredictable cravings; increased tolerance; increased dosing; increasing irritability, restlessness, and paranoia; paranoid psychosis; and auditory hallucinations.


Medical complications that may result from cocaine use disorder include heart rhythm abnormalities, heart attack, chest pain, respiratory failure, stroke, seizure, headache, abdominal pain, and nausea.




Screening and Diagnosis

A doctor who suspects cocaine use disorder will ask the patient about symptoms and medical history. He or she will also perform a physical examination. The doctor will ask specific questions about the cocaine use, such as how long the patient has been using the drug and how often.




Treatment and Therapy

A medical professional should be consulted to develop the best treatment plan for an individual suffering from cocaine use disorder. Treatment programs may be inpatient or outpatient. Treatment programs may require that the patient has already stopped using cocaine prior to treatment or they may involve a supervised detoxification program.


Medications can be used to help manage the symptoms of withdrawal, but there are currently no medications that have been approved to specifically treat cocaine use disorder. Medications that have shown some promise include modafinil (Provigil), N-acetylcysteine, topiramate (Topamax), disulfiram, agonist replacement therapy, and baclofen. Antidepressants may also be helpful for people in the early stages of cocaine abstinence. A 2015 study from the Yale School of Medicine also found that progesterone may be effective as a treatment for cocaine use disorder in women.


Behavioral therapies to help people quit using cocaine are often the only effective treatment for cocaine use disorder. These therapies use contingency management. With this program, people receive positive rewards for staying in treatment and remaining cocaine-free. Additionally, cognitive-behavioral therapy helps people to learn the skills needed to manage stress and prevent relapse.


Recovery programs such as Cocaine Anonymous provide community support for people seeking to recover from cocaine addiction. In rehabilitation programs, people with cocaine use disorder stay in a controlled environment for six to twelve months. During this time, they may receive vocational rehabilitation and other support to prepare them to return to society.




Prevention

The best way to prevent cocaine use disorder is to never use cocaine because the drug is highly addictive. Education programs on the dangers of cocaine use have helped to lower rates of cocaine use in the United States since the 1990s.




Bibliography


DiGirolamo, Gregory J., David Smelson, and Nathan Guevremont. "Cue-induced Craving in Patients with Cocaine Use Disorder Predicts Cognitive Control Deficits toward Cocaine Cues." Addictive Behaviors 47 (2015): 86–90. Print.



DuPont, Robert L. The Selfish Brain: Learning from Addiction. Center City.: Hazelton, 2000. Print.



Julien, Robert M., Claire D. Advokat, and Joseph Comaty. A Primer of Drug Action: A Comprehensive Guide to the Actions, Uses, and Side Effects of Psychoactive Drugs. 12th ed. New York: Worth, 2010. Print.



Shorter, Daryl, Coreen B. Domingo, and Thomas R. Kosten. "Emerging Drugs for the Treatment of Cocaine Use Disorder: A Review of Neurobiological Targets and Pharmacotherapy." Expert Opinion on Emerging Drugs 20.1 (2015): 15–29. Print.



Sosinsky, Alexandra. "Progesterone Reduces the Use of Cocaine in Postpartum Women with Cocaine Use Disorder." MGH Center for Women's Mental Health. Massachusetts General Hospital, 4 Feb. 2015. Web. 29 Oct. 2015.



Sussman, Steven, and Susan L. Ames. Drug Abuse: Concepts, Prevention, and Cessation. New York: Cambridge UP, 2008. Print.



Weil, Andrew, and Winifred Rosen. From Chocolate to Morphine: Everything You Need to Know About Mind-Altering Drugs. Rev. ed. Boston: Houghton Mifflin, 2004. Provides basic information about psychoactive substances to the general reader. Psychoactive substances are identified and defined. Also outlines the relationships between different types of drugs, the motivations to use drugs, and associated problems.

What are three ways to change the density of a gas?

Density of a substance is the ratio of its mass to its volume. That is,


density = mass/volume.


Thus, one way to change the density of a substance is by changing its volume. If the volume is decreased, say by compression, the density will increase. And an expansion will, similarly, cause the density to decrease.


Changes in temperature and pressure will cause changes in the density of a gas. When a gas is heated, its molecules gain more kinetic energy and move farther away from each other. This results in a less dense packing of molecules and hence lower density. Materials contract when frozen (water is an exception) and hence will have more density. Similarly, we can pressurize a gas and confine it to a smaller volume. This will cause an increase in density, as more molecules are present in the same volume.


Thus, changes in volume, pressure and temperature can cause density changes. Note that change in one of these factors may cause another factor to change as well.


Hope this helps. 

How do the lord's instructions to Bartholomew in the Induction introduce the main theme of the play?

In this opening scene, a bored nobleman decides to trick the drunken Sly into believing that he is a lord. The nobleman enlists his servants and a troup of players into the scheme and says that his page Bartholomew must dress as a lady and pretend to be Sly’s wife. The page must act like an ideal gentlewoman, who is described as being obedient, graceful, and courteous. He should say the following to Sly:



What is't your honour will command,
Wherein your lady and your humble wife
May show her duty and make known her love?



After that, he should show affection to, embrace, and kiss Sly, crying on command (something the lord calls “a woman's gift”). This description of a wife in no way fits the “shrew” Katharina who appears throughout the rest of the play. She does not possess a “soft low tongue and lowly courtesy” until after her taming. At the conclusion of The Taming of the Shrew, she describes the perfect woman, which matches the lord’s description in the Induction.


It is interesting that this is simply a boy playing a role of an ideal wife. He is not actually a woman, just as the actor playing Katharina would have been a young man or boy. Not only that, Katharina is being played by one of the players from the Induction. This device brings up questions as to how much characters in the play are just playing roles, such as chaste sister, obedient spouse, and mad husband. It also questions whether anyone can actually be the ideal wife, or if she can only play the role.

Tuesday, November 25, 2014

How did the Tohoku Earthquake and Tsunami (or Japan Earthquake and Tsunami of 2011) affect Japan, including economic and physical impacts?

On March 11, 2011, a magnitude-9 earthquake (referred to as the Tohoku Earthquake and Tsunami) hit Japan, and it created a tsunami. The earthquake was located 45 miles off the coast of Tohoku, 15 miles beneath the surface of the sea. It was centered in a subduction zone, where tectonic plates collide. Scientists had not predicted that an earthquake and tsunami of this magnitude would hit that area of Japan. Within about half an hour, the tsunami waves started hitting Japan, and they eventually spread 6 miles inland in some areas and up to 128 feet. Waves generated by the tsunami traveled across the Pacific Ocean to North and South America, bringing debris with them. 


The death toll to date for the earthquake and tsunami is 15,891, and most of the fatalities were the result of drowning. Over 2,500 people are still missing. A early-warning system allowed people in Tokyo to have a minute's warning about the earthquake, and high speed trains were stopped, preventing some injuries and deaths. The tsunami caused a meltdown at the Fukushima Daiichi Nuclear Power Plant. Radioactivity was leaked out, reaching as far as California, and it radioactive water continues to leak out of the plant. Together, the earthquake and tsunami caused an estimated $300 billion in damages, and much of the infrastructure in northeastern Japan was destroyed, including buildings, telecommunications, electricity lines, dams, and railroads. The Tohoku earthquake is estimated to have caused the greatest cost of any natural disaster in history. 

Describe the dogs that chased Snowball in Animal Farm.

The dogs that chased Snowball were the puppies he took from Jessie.


Napoleon was thinking ahead.  He knew from the very beginning that he would need to have some protection and reinforcement.  Before anyone was even thinking about the pigs taking power, he was planning to have his own secret security force created.



It happened that Jessie and Bluebell had both whelped soon after the hay harvest, giving birth between them to nine sturdy puppies. As soon as they were weaned, Napoleon took them away from their mothers, saying that he would make himself responsible for their education. (Ch. 3)



Napoleon took these puppies when they were young and had them kept secretly away from all of the other animals.  The other animals pretty much forgot about them.  Meanwhile, Napoleon had them secretly trained to become guard dogs and enforcers.  When Napoleon decided Snowball had outlived his usefulness, he had him run off.  He used the dogs to do it.  Almost fully grown, they were now big and scary.



At first no one had been able to imagine where these creatures came from, but the problem was soon solved: they were the puppies whom Napoleon had taken away from their mothers and reared privately. Though not yet full−grown, they were huge dogs, and as fierce−looking as wolves. (Ch. 4)



These dogs become Napoleon’s bodyguards.  They stay close to him, and if anyone says or does anything he disagrees with, then they growl and look scary.  The dogs also kill on Napoleon’s command, and soon no one is willing to say anything against Napoleon.


The secret dog police are an example of Napoleon’s cunning mind.  He realized that if he was going to manipulate everyone into giving him control, eventually he would need to use force.  Napoleon therefore arranged to take the animals with the sharpest teeth, animals that others would fear, and make them his enforcers so that no one could threaten his power.

Monday, November 24, 2014

What warning did Phoebus Apollo give Achilles before he went to battle with Hector?

In Book 22 of the Iliad, Achilles has returned to the battle after the death of Patroclus. He is the greatest warrior of the Greeks and enraged by the death of his lover. He first challenges Aeneas to battle.


Achilles has two advantages in battle. The first is his shield, forged by the god Hephaestus, which is unbreakable. The second is that as a baby he was dipped in the river Styx by his mother Thetis, making him invulnerable, except to injury in the heel where his mother held him. After a long exchange of boasts, Achilles and Aeneas fight, and Achilles nearly kills Aeneas. Poseidon intervenes at the last minute, conjuring up a dense fog, and saving Aeneas.


Hector is a brave and noble warrior who knows that if he fights Achilles he will die. However, as the leader of the Trojan army, his sense of honor makes him step forward to engage in combat with Achilles. Apollo tries to dissuade him from rashly engaging in single combat in which he is guaranteed to lose, saying:



"Don't for a moment duel Achilles, Hector,


out in front of your ranks!


Withdraw to your main lines and wait him there, 


out of the crash of battle. Else he'll spear you down


or close for the kill and hack you with his sword."



Hector initially takes Apollo's advice, but when Apollo kills Hector's brother Polydorus, Hector charges forward to attack Achilles.

What are some negative adjectives to describe Jeremy Atticus Finch (Jem) from To Kill a Mockingbird?

Jem, for the most part, is a good boy. He does his best to be the gentleman that Atticus wants him to be. There are some times, however, where he loses control of his temper and he can be rough and a little too aggressive with his little sister, Scout. For example, when Scout tells Dill not to believe Jem regarding Hot Steams in chapter 4, he doesn't say anything, but pushes her a little too aggressively down the road in the tire to teach her a lesson:



"Until it happened I did not realize that Jem was offended by my contradicting him on Hot Steams, and that he was patiently awaiting an opportunity to reward me. He did, by pushing the tire down the sidewalk with all the force in his body" (37).



Jem seems to be passive-aggressive in this instance because he "patiently" waits for an opportunity to get Scout back for contradicting him. He's not directly starting a fight with her, but hides behind the playful tire ride to quietly show her his disapproval of her.


At other times, Jem can be down-right aggressive and combative. Take the incident with Mrs. Dubose's camellia bushes in chapter 11, for instance. Jem has just bought a baton for Scout, but during a moment of crazed vindictiveness, he grabs it from her to take out his anger against Mrs. Dubose by chopping off the tops of the bushes. At the end of this brutal display of rage, he breaks the baton and roughs up Scout in the process.



"By that time I was shrieking. Jem yanked my hair, said he didn't care, he'd do it again if he got a chance, and if I didn't shut up he'd pull every hair out of my head. I didn't shut up and he kicked me. I lost my balance and fell on my face. Jem picked me up roughly but looked like he was sorry. There was nothing to say" (103).



During this incident, Jem is physically abusive and domineering. He may have looked sorry, but he is never apologetic towards Scout. The code of childhood must say that the look of regret in Jem's eyes was enough, and Scout doesn't hold it against her big brother. 

What is malpractice?


Controversies Surrounding Malpractice Litigation

In the United States, few medical topics arouse more anger in physicians, more debate in state legislatures, or more confusion in the public than malpractice. In part, the media encourages this attention when it reports multimillion-dollar jury awards for damages, sensational stories that often make all the parties involved—lawyers, the defendant doctor, the plaintiff patient, and juries—look somehow reprehensible. In part, the rise in malpractice insurance, which has contributed to the increasing cost of medical care, has upset both doctors and the public. Yet inflation and the rare spectacular settlement obscure the value of a system that since the late eighteenth century has given patients legal redress for injury, has helped maintain professional standards of medical care, and has allowed state governments some control over the local health care industry.


As the word’s elements imply, malpractice simply means the poor execution of duties. The definition bears close examination, however, on one key feature: what “poor” entails. The first recourse of a patient who feels inadequately cared for is to discuss the complaint with the doctor (or dentist, chiropractor, or other health care provider). This measure clears up many complaints, since most are based on simple misunderstandings. A patient receiving no satisfaction from the doctor may file a complaint with the state board of medical examiners, which is each state’s official government body, staffed by doctors, that issues medical licenses and disciplines physicians and surgeons. In both cases, the doctor or a panel of peers will decide if the patient’s complaint meets the professional standards of “poor.” A patient who is not pleased with this decision may bring suit in civil court. No patient, however, can press a lawsuit for malpractice simply because he or she feels wronged. For legal action to have any chance of succeeding, the doctor must have injured the patient because of negligent care. Even then, lawyers for the patient must rely on expert testimony from other doctors to establish that the physician gave the patient poor care. All official avenues of redress therefore depend on the medical profession’s own standards.


Four basic standards guide doctors in ethically performing their professional duties, and failure in any one of them may constitute malpractice. First, doctors must inform their patients about treatments for an ailment and receive their explicit consent. The patient must understand the doctor’s plan of treatment and any procedure’s potential risks and benefits; if a patient cannot understand because of age or mental condition, a guardian must consent, except in some emergency situations. The consent may be verbal unless an invasive technique, such as surgery, is involved, in which case the law requires a signed consent form. Without the patient’s consent, a physician performing a medical procedure not only may be subject to a malpractice lawsuit but also can be charged with assault under criminal law. Second, a doctor must treat a patient with reasonable skill, as defined by accepted medical practice. This point is crucial. Doctors do not have to render the best aid possible, or even the best aid of which they are capable; they must only meet professional guidelines for any specific diagnostic, palliative, or corrective measure. Both the key terms in this standard—“reasonable” and “accepted medical practice”—have been notoriously hard to define in court because they vary from region to region and from school of medicine to school of medicine. Rural physicians, for example, cannot be expected to give the level of care available in cities, since cities have more specialists available and support technology; nor are general practitioners expected to have the skill of a specialist, such as a cardiologist. Third, physicians are responsible for what other health care workers under their charge do to patients. If other doctors (such as medical residents), nurses, physical therapists, or medical technicians act on a doctor’s orders, that doctor is ultimately responsible for supervising their performance. Fourth, a doctor accepting responsibility for a patient enters a contractual obligation and may not abandon that obligation without either finding another physician to take his or her place or notifying the patient well in advance so the patient can engage another doctor. At the same time, however, the patient’s obligation is to follow the doctor’s medical advice.


Doctors are not the only health care workers who can be charged with malpractice. If other medical personnel act as a team with a doctor or surgeon, they may also be held liable. For example, during surgery a surgeon is assisted by an anesthesiologist and various nurses, any of whom may separately fail in his or her duties and be sued as a result. Thus, whenever a patient suffers at the hands of a medical team, the trend has been to sue each member. Furthermore, if the facilities or personnel employed by a hospital prove substandard, the hospital itself may be liable.


Tort liability and contractual responsibility govern the legal treatment of malpractice, both of which fall under civil law. (This classification assumes that doctors inadvertently cause harm; if they intentionally injure a patient, they are subject to charges under criminal law.) A patient may sue for breach of contract if his or her doctor has broken that contract—usually by abandoning the patient without proper notice. This sort of lawsuit is by far the least common. Tort liability means that the doctor is responsible for any injury (tort) caused to the patient through negligence. The patient may seek compensation for a tort by suing the doctor for damages. The presumption is that money, which is almost always the form of compensation sought, can make up for the harm done. Damages can be awarded for two types of injury. Concrete physical injury is the most typical, and damages may include money to cover medical bills, lost wages, convalescent care, and other expenses relating directly to the disability. A jury may also grant damages for pain and suffering, a difficult type of injury on which to place a price; such damages account for some of the largest monetary awards.


Because damages may amount to millions of dollars, most doctors who lose a malpractice suit cannot hope to pay them without help. Insurance provides that help, which usually takes one of three forms. First, for monthly payments (premiums), traditional insurance companies offer policies to doctors that will guarantee money up to a certain amount to pay damages. Also, if its client is sued, the insurance company assigns attorneys who handle the legal negotiations and the defense in court. Second, hospitals or other large organizations may pay for malpractice damages from a pool of money reserved for that purpose alone. Third, doctors and other health care providers may set up an insurance company of their own for mutual coverage, often called “bedpan mutuals.”


Malpractice litigation in the United States is a ponderous, expensive business. In the mid-1970s, malpractice insurance prices began to rise sharply; between 1983 and 1985 alone, the cost increased 100 percent. Malpractice premiums remained relatively flat during the 1990s. By the end of the decade, however, physicians began to be hit with unexpectedly large increases. In 2001, eight states saw two or more liability insurers raise rates by at least 30 percent, according to the American Medical Association, and doctors in more than a dozen states saw one or more insurers charge at least 25 percent more for medical malpractice insurance. The George W. Bush presidential administration released a report in 2002 that found the price of malpractice insurance for certain high-risk specialists increased about 10 percent in 2001 alone and was expected to rise another 20 percent between 2002 and 2003. From 1996 to 1999, jury awards for medical malpractice claims jumped 76 percent, according to Jury Verdict Research. Doctors pass on some or all of these costs to patients by charging higher fees. If a patient sues, however, the insurance cannot cover every type of loss. The amount of time that a doctor must spend with lawyers, the time in court, and the overall distraction from practicing mean reduced earnings. Yet the cost is not only to the doctor. The plaintiff pays attorneys by contingency fee, which means that the attorney receives a percentage (usually 20 to 30 percent) of money from any settlement. A patient losing a suit does not pay the attorney but still must pay court costs and expenses, which can quickly amount to thousands of dollars. Finally, when suits reach court, public funds contribute to the court’s expenses, and those expenses climb if a decision is appealed or retried, as is sometimes the case.


Patients and doctors alike complain that soaring malpractice litigation in the United States since 1960 has been destructive, introducing suspicion into the doctor-patient relationship. In addition to its emotional impact, the suspicion concretely affects medical practice, most medical economists claim. Because physicians fear lawsuits, they perform more diagnostic tests than are called for by medical protocols. Often the chances are remote that these tests will reveal any useful information, yet doctors order them to show that they have done everything possible for the patient if they are sued. The extra tests cost money, which either the patient or the insurance company must pay. In either case, the expenditures inflate the cost of medicine. The practice of such “defensive medicine” has also led some doctors to refuse to perform high-risk procedures except in hospitals that have extensive facilities. Obstetricians provide a signal case in point. Fearing lawsuits for any complications that may arise, many obstetricians will not deliver babies at home or in small hospitals, forcing rural patients to rush long distances to the nearest big-city hospital for delivery.


One scholar of the malpractice system has remarked that it seems designed to protect the interests of everyone except the person who most needs help: the injured patient. While this is surely a rhetorical exaggeration, all studies have found that only a fraction of injuries are ever compensated. Moreover, the system, based on adversarial disputation, seems hostile and dauntingly complex to both patient and physician. Yet, although no one thinks it perfect, the system evolved in accordance with two widely held American attitudes toward regulation in general: it limits abuses, and it preserves professional autonomy.




Trial Procedures in Malpractice Cases

Few malpractice claims actually end in jury awards for damages. Only about 10 percent of patients injured by doctors file lawsuits, of which about 20 percent end in payment to the plaintiff. Overwhelmingly the payments come from out-of-court settlements that win the plaintiff only a part of the money sought in the suit. Taking a suit all the way to a jury settlement is risky for plaintiffs; they win only about two in ten cases.


From the outset, then, the chances are against the injured patient, and for this reason malpractice litigation is not popular among lawyers. To have a reasonable chance to win a case in court, or at least to force the doctor’s insurance company to offer a settlement out of court, the lawyer must first be sure that a causal connection can be made between the patient’s injury and physician negligence. In other words, patients cannot sue simply on the hope of winning damages; courts try to reject such “frivolous” suits before they come to trial.


A lawyer who believes that a reasonable causal link can be established will write up a summons and complaint on the client’s behalf and send them to the doctor. The summons warns the doctor that the patient is filing a lawsuit. The complaint explains the patient’s allegation of harm and the amount of damages that the patient demands in compensation. The doctor must answer in a specific time—about a month in most states—and the answer, issued through the doctor’s lawyers or those of his or her insurance company, almost always denies responsibility for any injury. The legal battle is then joined.


During a pretrial period known as discovery, each side investigates the other, hoping to find facts that will support arguments in court. Lawyers rely on three investigative methods. The first is documentary disclosure. The plaintiff’s lawyer will demand records, especially the patient’s medical record, and the doctor must furnish them in a reasonable time. In the second method, written interrogatories, the plaintiff’s lawyer sends the doctor a list of questions that must be answered in writing. Third is the deposition, a formal legal proceeding. Lawyers from both sides meet and together question, in separate sessions, the defendant, plaintiff, and key witnesses, all of whom answer the questions under oath, so that they are guilty of perjury if they lie. Many suits are dropped during discovery, with or without monetary settlement. If the suit continues but one side has little evidence on which to base arguments, the other side will probably file a motion for summary judgment, which essentially asks a judge to end the litigation by disqualifying the weak case. Discovery and pretrial motions may take years to complete.


Trials follow a pattern, with some variations, designed to allow each side to present claims and counterclaims systematically. A trial starts with opening statements in which the lawyers describe the general plan for their cases; no actual arguments are made. Next, to clarify matters for the jury, the judge may summarize the applicable legal principles for the case. Then witnesses are called and questioned, first by the plaintiff’s lawyer. After he or she finishes with each witness, the defendant’s lawyer may also ask questions, a procedure called cross-examination. When the plaintiff’s side is done calling witnesses, then the defense lawyer calls and questions more, which the lawyer for the plaintiff may also cross-examine.


During the questioning, two types of evidence are admitted: testimony, the oral or written statements of what people have seen or heard, and “real” or “demonstrative” evidence, physical objects such as an x-ray or a needle that have a bearing on the case. The testimony is crucial for the plaintiff, because at this point an expert witness must swear that the defendant was negligent to a “medical certainty” by failing to adhere to one or more medical standards of practice. Since only a doctor is qualified to make this judgment, expert witnesses are always physicians. Finally, the lawyers make closing statements, each insisting that the evidence supports the position of his or her client, and the jury retires to decide on a verdict. If the jurors decide in favor of the plaintiff, they can also lower or raise the amount of requested damages. If they decide for the defendant, the doctor, then the case ends without a monetary settlement. A victorious plaintiff cannot expect immediate payment. Appeals to higher courts may last years, and the appellate courts, after examining the trial records, can reverse a verdict, change the amount of damages, or order a new trial.


Even if a trial does get under way, however, it may not end in a verdict. At any point in the proceedings, one side or the other may give up. Insurance companies regularly send observers to malpractice trials who assess the progress of arguments objectively. An observer detecting a weakness in the defense or noticing that the jury favors the plaintiff for any reason will offer a settlement to the plaintiff’s lawyer, because such a settlement will save court costs and probably involve less money than a jury award for damages. Likewise, the plaintiff’s lawyer, recognizing that the chances of winning are slim, may try to make a deal with the insurance company. Such dickering may even continue after a verdict is announced, if it is appealed. Also, at any point in the trial the judge may end the case if he or she thinks that one side cannot possibly win; similarly, the judge may reverse a verdict or change the amount of damages if the jury’s decision shocks his or her professional conscience.




Perspective and Prospects

By the mid-1970s, the entire American health care system, in the view of most health care observers, was in a state of crisis. Costs had risen, and facilities, especially in urban areas, were strained, while rural areas were often underserved. Critics have blamed the problems on increasingly costly technology and drugs, government regulation, professional salaries, and inadequate preventive medicine. Few doubt that malpractice litigation has contributed significantly as well.


Estimates in 1993 claimed that defensive medicine alone had increased the annual cost of American health care from $10 billion to $36 billion. A 2013 study published in Health Affairs found that the costs of defensive medicine and medical liability added up to about $55.6 billion or 2.4 percent of healthcare spending in the United States in 2008. Combined with increasing fees for medical services and other costs, defensive medicine has helped drive up the cost of medical insurance. Because of these financing problems, legislatures around the country have tried to control the increasing numbers of malpractice suits with tort reform, arbitration or review panels, and legal fee limits.


In 2002, lawmakers in Ohio and other states began attempting to drive down premiums by passing laws that limit the jury awards injured patients can be given for pain and suffering. The Bush administration also supported a nationwide limit of $250,000 on these damages, although questions remain about how well the caps work. In 2010, President Obama signed the Patient Protection and Affordable Care Act (ACA), which encourages states to find and test alternatives to their existing litigation systems in order to improve patient safety; reduce medical errors; resolve disputes efficiently, promptly, and fairly; ensure better access to liability insurance; and preserve an individual's right to seek legal redress. The ACA also states that Congress should consider starting a state demonstration program to weigh alternatives to the existing civil litigation system. Critics of the ACA have claimed that it does not do enough to reduce the practice of defensive medicine.


Tort reforms include a number of measures that modify the procedures or awards of malpractice litigation. Two reforms are designed to shorten the process. One method is to reduce the statute of limitations for malpractice claims—the period after injury when a lawsuit can be started. The second involves limiting the rules governing the discovery phase of pretrial action. Two further reforms restrict the amount of damages. The most popular of these is to impose maximum amounts for types of injury, especially pain and suffering. In the second reform, jury damages must be reduced by the amount of money from other sources, such as health insurance, that a patient receives for the injury.


Several states have instituted review panels or required arbitration before a suit can proceed to court. Laypeople and judges, as well as doctors, make up the review panels, which try to identify and disallow frivolous suits. Arbitration panels actually decide on the amount of damages, if any, to be made, and their decisions cannot be appealed.


These reforms have only slowed the rate of lawsuits and the rise in the amount of money spent on paying damages and fees. Whatever its defects, the tort system has succeeded in making doctors wary of negligence. Critics insist, however, that the system for addressing malpractice has punished all physicians, not simply the incompetent, and has contributed to the increasingly litigious tenor of American society.




Bibliography


Frese, R. C., and P. J. Kitchen. "Perspectives on Medical Malpractice Self-Insurance Financial Reporting." Healthcare Financial Management: Journal of the Healthcare Financial Management Association 66.11 (2012): 50–52, 54. Print.



Furrow, Barry R., et al. Health Law: Cases, Materials and Problems. 7th ed. St. Paul: West Academic, 2013. Print.



Groopman, Jerome E. Second Opinions: Stories of Intuition and Choice in the Changing World of Medicine. New York: Viking, 2000. Print.



Jonsen, Albert R., Mark Siegler, and William J. Winslade. Clinical Ethics: A Practical Approach to Ethical Decisions in Clinical Medicine. 7th ed. New York: McGraw, 2010. Print.



Kulkami, Shefali S. "Fearful Doctors May Order Too Many Tests." MedlinePlus, 14 Aug. 2013. Web.



Leflar, Robert B. "Medical Malpractice Reform Measures and Their Effects." CHEST 144.1 (2013): 306–18. Print.



MedlinePlus. "Patient Rights." MedlinePlus, 25 June 2013. Web.



Mehlman, Maxwell J. "Medical Practice Guidelines as Malpractice Safe Harbors: Illusion or Deceit?" Journal of Law, Medicine & Ethics 40.2 (2012): 286–300. Print.



Merry, Alan, and Alexander McCall Smith. Errors, Medicine, and the Law. New York: Cambridge UP, 2008. Print.



Pence, Gregory. Classic Cases in Medical Ethics: Accounts of Cases That Have Shaped Medical Ethics, with Philosophical, Legal, and Historical Backgrounds. 5th ed. New York: McGraw, 2008. Print.



Sage, William M., and Rogan Kersh, eds. Medical Malpractice and the U.S. Health Care System. New York: Cambridge UP, 2006. Print.



Sharpe, Virginia F., and Alan I. Faden. Medical Harm: Historical, Conceptual, and Ethical Dimensions of Iatrogenic Illness. New York: Cambridge UP, 1998. Print.



Williams, Alan G. "The Cure for What Ails: A Realistic Remedy for the Medical Malpractice 'Crisis.'" Stanford Law & Policy Review 23.2 (2012): 477–521. Print.



Zobel, Hiller B., and Stephen N. Rous. Doctors and the Law: Defendants and Expert Witnesses. New York: Norton, 1993. Print.

How does the choice of details set the tone of the sermon?

Edwards is remembered for his choice of details, particularly in this classic sermon. His goal was not to tell people about his beliefs; he ...